3.3.1.16 FOXP

Selected matrix:   TRANSFAC matrix:
(Genome version:
V$FOXP1_01
hg19)
  Selected species:
Viewing:        

Sort order: score(DESC)


chromosome Sort DescendingSort Ascending| start Sort DescendingSort Ascending| end Sort DescendingSort Ascending|gene name Sort DecendingSort Ascending|TFBS_Sequence|scoreSort DescendingSort Ascending|locationSort DescendingSort Ascending
chr2|233497753|233497773|EFHD1|TTATTTGTTTTTAGTATTTT| 0.897| +
chr6|21593514|21593534|SOX4|TTATTTTTATTAGTTCTTTT| 0.896| -

Page 1 of 1

To sort the sites according to the values in a specific column in ascending () or descending () order,
click on the respective symbol in the column header. Click again to deactivate the sorting criteria.
To define multiple sorting criteria, click on the sorting symbols (,) of the corresponding columns in
the order you wish to have the sorting applied. The hierarchy of sorting criteria will be displayed above.