CTCF-like factors

Selected matrix:   TRANSFAC matrix:
(Genome version:
  Selected species:

Sort order: none

chromosome Sort DescendingSort Ascending| start Sort DescendingSort Ascending| end Sort DescendingSort Ascending|gene name Sort DecendingSort Ascending|TFBS_Sequence|scoreSort DescendingSort Ascending|locationSort DescendingSort Ascending
chr20|42085639|42085659|GNAI2|GCCGCCACCAGGGGGCGCCC| 0.997| -
chr9|7704262|7704282|MRPL38|CGGGCCACCAGGGGGCGGCA| 0.991| +
chr9|50963107|50963127|C17orf85|CCCGCCACCAGGGGGCGGCG| 0.992| -
chr16|22429008|22429028|NOM1|CCCGCCAGCAGGGGGCGCCG| 0.991| +
chr2|44599167|44599187|DPYSL3|ACGGCCACCAGGGGGCGCGA| 0.996| +
chr8|7158158|7158178|IRF9|CGCGCCACCAGGGGGCGGCA| 0.989| -
chr24|29892513|29892533|LOC388796|CCCGCCACCAGGGGGCGCGA| 0.995| -

Page 1 of 1

To sort the sites according to the values in a specific column in ascending () or descending () order,
click on the respective symbol in the column header. Click again to deactivate the sorting criteria.
To define multiple sorting criteria, click on the sorting symbols (,) of the corresponding columns in
the order you wish to have the sorting applied. The hierarchy of sorting criteria will be displayed above.